Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

psiCHECK2 RPS28 UTR1 WT
(Plasmid #203157)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 203157 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    psiCHECK2
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPS28 UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    207
  • Entrez Gene
    RPS28 (a.k.a. DBA15, S28, eS28)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer TCCAGAGCCTGTCCACGTAT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

207 bp region of the human RPS28 UTR containing two MIR-28 binding sites (WT). Cloned from MCF10A cell line genomic DNA.

Please visit https://pubmed.ncbi.nlm.nih.gov/36824951/ for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2 RPS28 UTR1 WT was a gift from Susan Baserga (Addgene plasmid # 203157 ; http://n2t.net/addgene:203157 ; RRID:Addgene_203157)
  • For your References section:

    Discovery of novel microRNA mimic repressors of ribosome biogenesis. Bryant CJ, McCool MA, Rosado Gonzalez GT, Abriola L, Surovtseva YV, Baserga SJ. Nucleic Acids Res. 2024 Feb 28;52(4):1988-2011. doi: 10.1093/nar/gkad1235. 10.1093/nar/gkad1235 PubMed 38197221