Skip to main content

pHD22y/PfPRMT5-PTP
(Plasmid #203160)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203160 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHD22Y
  • Backbone manufacturer
    Wellems T lab
  • Backbone size w/o insert (bp) 5818
  • Total vector size (bp) 2410
  • Modifications to backbone
    No
  • Vector type
    Mammalian Expression
  • Selectable markers
    hdhfr

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PfPRMT5 fragment, PTP tag and pDT 3' UTR
  • Species
    Plasmodium falciprum 3D7
  • Insert Size (bp)
    2410
  • GenBank ID
    XM_001350285.1
  • Promoter No
  • Tags / Fusion Proteins
    • PTP tags (C terminal on backbone)
    • 3' UTR of P. berghei dihydrofolate reductase/thymidylate synthase (dhfr/ts) gene (pDT)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GATAATTTGTCCTCCCAGACTT
  • 3′ sequencing primer GCGGCCGCCTACCCTGAAGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We cloned the C-terminal fragment of PfPRMT5, PTP tags, and 3' UTR region of P. berghei dihydrofolate reductase/thymidylate synthase (dhfr/ts) gene (pDT) into pHD22Y vector. This vector is used for tagging of the PfPRMT5 gene with PTP tag in the malaria parasite Plasmodium falciparum by single crossover.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD22y/PfPRMT5-PTP was a gift from Liwang Cui (Addgene plasmid # 203160 ; http://n2t.net/addgene:203160 ; RRID:Addgene_203160)
  • For your References section:

    A type II protein arginine methyltransferase regulates merozoite invasion in Plasmodium falciparum. Lucky AB, Wang C, Liu M, Liang X, Min H, Fan Q, Siddiqui FA, Adapa SR, Li X, Jiang RHY, Chen X, Cui L, Miao J. Commun Biol. 2023 Jun 22;6(1):659. doi: 10.1038/s42003-023-05038-z. 10.1038/s42003-023-05038-z PubMed 37349497