pML12
(Plasmid
#203341)
-
PurposeSR latch circuit on pLW555 backbone: PTac-S3, PTet-E1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLW555
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7629
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namesrpR
-
Insert Size (bp)642
- Promoter PTac and PBetI
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TGGCTCATAACACCCCTTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namebetI
-
Insert Size (bp)588
- Promoter PSrpR and PTet
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GAAGAAGCACAGATTAAACAGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML12 was a gift from Lauren Andrews (Addgene plasmid # 203341 ; http://n2t.net/addgene:203341 ; RRID:Addgene_203341) -
For your References section:
Algorithmic Programming of Sequential Logic and Genetic Circuits for Recording Biochemical Concentration in a Probiotic Bacterium. Lebovich M, Zeng M, Andrews LB. ACS Synth Biol. 2023 Aug 15. doi: 10.1021/acssynbio.3c00232. 10.1021/acssynbio.3c00232 PubMed 37581922