Skip to main content
Addgene

pWR88
(Plasmid #203422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203422 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAllet
  • Backbone manufacturer
    Robertson
  • Backbone size w/o insert (bp) 2216
  • Total vector size (bp) 8072
  • Modifications to backbone
    coKanMX and coCBG expression cassettes from pWR23 were moved to pAllet. Duplicate portions of LacZ with an added YUM1 sgRNA targeting sequence (aka a CAR sequence) was added upstream and downstream of the coKanMX/coCBG expression element.
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CAR copy 1
  • Alt name
    (portion of LacZ)
  • Species
    E. coli
  • Insert Size (bp)
    634

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AAAGTGCCACCTGACGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    P(TEF1)/coKanMX/T(ACT1) + P(TDH3)/coCBG/T(ADH2)
  • Species
    Synthetic; S. stipitis (yeast)
  • Insert Size (bp)
    4753

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GATCTTGCATGCCTCTAGAC
  • 3′ sequencing primer AGTTGGCCACCTTAAGATC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    CAR copy 2
  • Alt name
    (portion of LacZ)
  • Species
    E. coli
  • Insert Size (bp)
    637

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer ACAATTTAACGAGAGCAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWR88 was a gift from J. Brian Robertson (Addgene plasmid # 203422 ; http://n2t.net/addgene:203422 ; RRID:Addgene_203422)
  • For your References section:

    BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937