pWR88
(Plasmid
#203422)
-
Purposeempty BLINCAR plasmid for payload delivery, no payload, no genomic target
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAllet
-
Backbone manufacturerRobertson
- Backbone size w/o insert (bp) 2216
- Total vector size (bp) 8072
-
Modifications to backbonecoKanMX and coCBG expression cassettes from pWR23 were moved to pAllet. Duplicate portions of LacZ with an added YUM1 sgRNA targeting sequence (aka a CAR sequence) was added upstream and downstream of the coKanMX/coCBG expression element.
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCAR copy 1
-
Alt name(portion of LacZ)
-
SpeciesE. coli
-
Insert Size (bp)634
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AAAGTGCCACCTGACGTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameP(TEF1)/coKanMX/T(ACT1) + P(TDH3)/coCBG/T(ADH2)
-
SpeciesSynthetic; S. stipitis (yeast)
-
Insert Size (bp)4753
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GATCTTGCATGCCTCTAGAC
- 3′ sequencing primer AGTTGGCCACCTTAAGATC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCAR copy 2
-
Alt name(portion of LacZ)
-
SpeciesE. coli
-
Insert Size (bp)637
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer ACAATTTAACGAGAGCAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycoCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR88 was a gift from J. Brian Robertson (Addgene plasmid # 203422 ; http://n2t.net/addgene:203422 ; RRID:Addgene_203422) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937