pC130: pAAV.CMV-CasRx-VEGFA sgRNA
(Plasmid
#203443)
-
PurposePlasmid expressing active RfxCas13d with VEGFA mRNA targeting gRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV.CMV-BGHpA
-
Backbone manufacturerVectorBuilder
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6-VEGFA sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)375
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRfxCas13d
-
Alt nameCasRx
-
SpeciesRuminococcus flavefaciens XPD3002
-
Insert Size (bp)3000
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- NLS (N terminal on insert)
- HA (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC130: pAAV.CMV-CasRx-VEGFA sgRNA was a gift from Guei-Sheung Liu (Addgene plasmid # 203443 ; http://n2t.net/addgene:203443 ; RRID:Addgene_203443) -
For your References section:
Characterization of RNA editing and gene therapy with a compact CRISPR-Cas13 in the retina. Kumar S, Hsiao YW, Wong VHY, Aubin D, Wang JH, Lisowski L, Rakoczy EP, Li F, Alarcon-Martinez L, Gonzalez-Cordero A, Bui BV, Liu GS. Proc Natl Acad Sci U S A. 2024 Nov 5;121(45):e2408345121. doi: 10.1073/pnas.2408345121. Epub 2024 Oct 30. 10.1073/pnas.2408345121 PubMed 39475642