Skip to main content
Addgene

pM156: pAAV.CMV-Cas13e (GenScript CO)-VEGFA sgRNA
(Plasmid #203452)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203452 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CMV-BGHpA
  • Backbone manufacturer
    VectorBuilder
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    U6-VEGFA sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    375
  • Promoter U6

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Cas13e
  • Alt name
    Cas13X.1, Cas13bt3
  • Species
    Ruminococcus flavefaciens XPD3002
  • Insert Size (bp)
    2403
  • Promoter CMV
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • NLS (N terminal on insert)
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM156: pAAV.CMV-Cas13e (GenScript CO)-VEGFA sgRNA was a gift from Guei-Sheung Liu (Addgene plasmid # 203452 ; http://n2t.net/addgene:203452 ; RRID:Addgene_203452)
  • For your References section:

    Characterization of RNA editing and gene therapy with a compact CRISPR-Cas13 in the retina. Kumar S, Hsiao YW, Wong VHY, Aubin D, Wang JH, Lisowski L, Rakoczy EP, Li F, Alarcon-Martinez L, Gonzalez-Cordero A, Bui BV, Liu GS. Proc Natl Acad Sci U S A. 2024 Nov 5;121(45):e2408345121. doi: 10.1073/pnas.2408345121. Epub 2024 Oct 30. 10.1073/pnas.2408345121 PubMed 39475642