p Pcrg1: Khd4-Ada-Gfp (CbxR)
(Plasmid #203734)

• Purpose: Plasmid for ectopic integration and expression of Khd4-Ada-Gfp. The 4282 bp khd4-ORF is fused C-terminally to the 1200 bp adar catalytic domain (Ada) with three repeats of GGGGS linker in between, fol
• Depositing Lab: Michael Feldbrügge
• Publication: Sankaranarayanan et al Proc Natl Acad Sci U S A. 2023 Aug 22;120(34):e2301731120. doi: 10.1073/pnas.2301731120. Epub 2023 Aug 17.

Backbone

• Vector backbone: pMF2-1c
• Backbone size w/o insert (bp): 6763
• Total vector size (bp): 12997
• Vector type: Bacterial Expression
• Selectable markers: Carboxin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Khd4-Ada-Gfp
• Alt name: Khd4-hyperTRIBE
• Species: D. melanogaster (fly); Ustilago maydis
• Insert Size (bp): 6234
• GenBank ID: XM_011391969.1 AHN59262.1
• Promoter: Pcrg1
• Tag / Fusion Protein:
  • Gfp (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sfi1 (not destroyed)
• 3′ cloning site: Asc1 (not destroyed)
• 5′ sequencing primer: GGCCTGATGGGCCATGGATTTCTACTCGACGTCCTTC
• 3′ sequencing primer: TCGCAAGACCGGCAACAG

Resource Information

• Supplemental Documents:
  • pPcrg1_Khd4-Ada-Gfp (CbxR).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry