p Pcrg1: Khd4-Ada-Gfp (CbxR)
(Plasmid
#203734)
-
PurposePlasmid for ectopic integration and expression of Khd4-Ada-Gfp. The 4282 bp khd4-ORF is fused C-terminally to the 1200 bp adar catalytic domain (Ada) with three repeats of GGGGS linker in between, fol
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMF2-1c
- Backbone size w/o insert (bp) 6763
- Total vector size (bp) 12997
-
Vector typeBacterial Expression
-
Selectable markersCarboxin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKhd4-Ada-Gfp
-
Alt nameKhd4-hyperTRIBE
-
SpeciesD. melanogaster (fly); Ustilago maydis
-
Insert Size (bp)6234
-
GenBank IDXM_011391969.1 AHN59262.1
- Promoter Pcrg1
-
Tag
/ Fusion Protein
- Gfp (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfi1 (not destroyed)
- 3′ cloning site Asc1 (not destroyed)
- 5′ sequencing primer GGCCTGATGGGCCATGGATTTCTACTCGACGTCCTTC
- 3′ sequencing primer TCGCAAGACCGGCAACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p Pcrg1: Khd4-Ada-Gfp (CbxR) was a gift from Michael Feldbrügge (Addgene plasmid # 203734 ; http://n2t.net/addgene:203734 ; RRID:Addgene_203734) -
For your References section:
The mRNA stability factor Khd4 defines a specific mRNA regulon for membrane trafficking in the pathogen Ustilago maydis. Sankaranarayanan S, Haag C, Petzsch P, Kohrer K, Matuszynska A, Zarnack K, Feldbrugge M. Proc Natl Acad Sci U S A. 2023 Aug 22;120(34):e2301731120. doi: 10.1073/pnas.2301731120. Epub 2023 Aug 17. 10.1073/pnas.2301731120 PubMed 37590419