pWR95
(Plasmid
#203916)
-
PurposeBLINCAR plasmid for gene deletion, no genomic target
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWR88
-
Backbone manufacturerRobertson
- Backbone size w/o insert (bp) 8072
- Total vector size (bp) 8093
-
Modifications to backbonepAllet was digested with EcoRV and SalI, blunted, and religated. Then the AgeI to XbaI portion of this modified MCS was moved to pWR88 using AgeI and XbaI.
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemodified MCS
-
SpeciesSynthetic; S. stipitis (yeast)
-
Insert Size (bp)85
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CACGGAAATGTTGAATACTC (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR95 was a gift from J. Brian Robertson (Addgene plasmid # 203916 ; http://n2t.net/addgene:203916 ; RRID:Addgene_203916) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937