Skip to main content
Addgene

pWR95
(Plasmid #203916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203916 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWR88
  • Backbone manufacturer
    Robertson
  • Backbone size w/o insert (bp) 8072
  • Total vector size (bp) 8093
  • Modifications to backbone
    pAllet was digested with EcoRV and SalI, blunted, and religated. Then the AgeI to XbaI portion of this modified MCS was moved to pWR88 using AgeI and XbaI.
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    modified MCS
  • Species
    Synthetic; S. stipitis (yeast)
  • Insert Size (bp)
    85

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACGGAAATGTTGAATACTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWR95 was a gift from J. Brian Robertson (Addgene plasmid # 203916 ; http://n2t.net/addgene:203916 ; RRID:Addgene_203916)
  • For your References section:

    BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937