pWR95(URA3)
(Plasmid
#203917)
-
PurposeBLINCAR plasmid for gene deletion, URA3 target
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWR95
-
Backbone manufacturerRobertson
- Backbone size w/o insert (bp) 8093
- Total vector size (bp) 12000
-
Modifications to backboneupstream and downstream homology regions for URA3 were added to pWR95
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameURA3 upstream homology
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)1986
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CACGGAAATGTTGAATACTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameURA3 downstream homology
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)2038
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer TTCAGAAGGCAGAACTAGT
- 3′ sequencing primer ACCTCTGACTTGAGCGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bycoCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR95(URA3) was a gift from J. Brian Robertson (Addgene plasmid # 203917 ; http://n2t.net/addgene:203917 ; RRID:Addgene_203917) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937