plko_TRE3G_Myc-Sox9WT_PGKpuroR
(Plasmid
#203962)
-
PurposeDox inducible WT SOX9 with myc tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO
- Total vector size (bp) 9641
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX9
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1533
-
Entrez GeneSox9 (a.k.a. 2010306G03Rik, mKIAA4243, mSox9)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agctttaggcgtgtacgg
- 3′ sequencing primer GGCTGCCTTGGAAAAGGCGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plko_TRE3G_Myc-Sox9WT_PGKpuroR was a gift from Elaine Fuchs (Addgene plasmid # 203962 ; http://n2t.net/addgene:203962 ; RRID:Addgene_203962) -
For your References section:
The pioneer factor SOX9 competes for epigenetic factors to switch stem cell fates. Yang Y, Gomez N, Infarinato N, Adam RC, Sribour M, Baek I, Laurin M, Fuchs E. Nat Cell Biol. 2023 Jul 24. doi: 10.1038/s41556-023-01184-y. 10.1038/s41556-023-01184-y PubMed 37488435