pMRMTK-clo12
(Plasmid
#203982)
-
PurposeCloning plasmid containing the rrnB T1 terminator insert with a chloramphenicol resistance marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneR6Kγ origin of replication, oriT & chloramphenicol resistance gene
- Backbone size w/o insert (bp) 1607
- Total vector size (bp) 1687
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namerrnB T1 Terminator
-
Insert Size (bp)80
- Promoter N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer gtaacgcactgagaagcccttagag
- 3′ sequencing primer CCTGCCACTCATCGCAGTACTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.05.543168v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRMTK-clo12 was a gift from Nathan Crook (Addgene plasmid # 203982 ; http://n2t.net/addgene:203982 ; RRID:Addgene_203982) -
For your References section:
Engineering the Maize Root Microbiome: A Rapid MoClo Toolkit and Identification of Potential Bacterial Chassis for Studying Plant-Microbe Interactions. van Schaik J, Li Z, Cheadle J, Crook N. ACS Synth Biol. 2023 Oct 20;12(10):3030-3040. doi: 10.1021/acssynbio.3c00371. Epub 2023 Sep 15. 10.1021/acssynbio.3c00371 PubMed 37712562