Skip to main content

pMRMTK-clo39
(Plasmid #204014)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204014 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    R6Kγ origin of replication, oriT & chloramphenicol resistance gene
  • Backbone size w/o insert (bp) 1607
  • Total vector size (bp) 2332
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    super folder green fluorescent protein
  • Insert Size (bp)
    725
  • Promoter N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer gtaacgcactgagaagcccttagag
  • 3′ sequencing primer CCTGCCACTCATCGCAGTACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRMTK-clo39 was a gift from Nathan Crook (Addgene plasmid # 204014 ; http://n2t.net/addgene:204014 ; RRID:Addgene_204014)
  • For your References section:

    Engineering the Maize Root Microbiome: A Rapid MoClo Toolkit and Identification of Potential Bacterial Chassis for Studying Plant-Microbe Interactions. van Schaik J, Li Z, Cheadle J, Crook N. ACS Synth Biol. 2023 Oct 20;12(10):3030-3040. doi: 10.1021/acssynbio.3c00371. Epub 2023 Sep 15. 10.1021/acssynbio.3c00371 PubMed 37712562