pUCmini-NFKB1-PGK-tdTomato
(Plasmid
#204019)
-
PurposeHomologous donor template for NFKB1 knockout expressing tdTomato
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC-mini
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdTomato
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer atggtgagcaagggcgaggaggtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCmini-NFKB1-PGK-tdTomato was a gift from Yohei Sato (Addgene plasmid # 204019 ; http://n2t.net/addgene:204019 ; RRID:Addgene_204019) -
For your References section:
Non-canonical NFKB signaling endows suppressive function through FOXP3-dependent regulatory T cell program. Sato Y, Osada E, Manome Y. Heliyon. 2023 Nov 26;9(12):e22911. doi: 10.1016/j.heliyon.2023.e22911. eCollection 2023 Dec. 10.1016/j.heliyon.2023.e22911 PubMed 38125410