pUDE1093
(Plasmid
#204227)
-
PurposeEpisomal yeast plasmid expressing the Ercas12a
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGGKd018
-
Backbone manufacturerRandazzo P, Bennis NX, Daran JM, Daran-Lapujade P. gEL DNA: A Cloning- and Polymerase Chain Reaction-Free Method for CRISPR-Base
- Total vector size (bp) 9495
-
Modifications to backboneAssembled by golden gate cloning
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEubacterium rectale cas12a (Ercas12a)
-
Alt nameMAD7
-
SpeciesSynthetic; Eubacterium rectale
-
Insert Size (bp)3789
-
Mutationcodon optimized for S. cerevisiae
-
GenBank IDMH347339.1
- Promoter Saccharomyces cerevisiae PGK1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ATGAACAACGGTACTAACAACTTCC
- 3′ sequencing primer TTACACCTTCCTCTTCTTCTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe original Ercas12a gene sequence was retrieved from Inscripta Inc. (https://www.inscripta.com/products/madzymes-nucleases, consulted April 2020, WP_055225123.1).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDE1093 was a gift from Jean-Marc Daran (Addgene plasmid # 204227 ; http://n2t.net/addgene:204227 ; RRID:Addgene_204227) -
For your References section:
Expanding the genome editing toolbox of Saccharomyces cerevisiae with the endonuclease ErCas12a. Bennis NX, Anderson JP, Kok SMC, Daran JG. FEMS Yeast Res. 2023 Jan 4;23:foad043. doi: 10.1093/femsyr/foad043. 10.1093/femsyr/foad043 PubMed 37791490