AAVS1-Hb9-CD14
(Plasmid
#204344)
-
PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAVS1-CAG-hrGFP
-
Backbone manufacturerSu-Chun Zhang - plasmid# 52344
- Backbone size w/o insert (bp) 7100
- Total vector size (bp) 18000
-
Modifications to backboneThe Not1 site in the backbone was deleted, and the CAG-hrGFP sequence was removed. The original insert was replaced by the 9kb Hb9 promoter (PMID: 10482234), a 5' splice substrate (PMID: 2038318), the human CD14 gene (PMID: 24496616) and the bGH-poly-A signal (PMID: 6146135). This entire cassette can be excised by Not1/Pac1 digest.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman CD14
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1159
-
GenBank IDNM_000591
-
Entrez GeneCD14
- Promoter mouse Hb9 (Mnx1) 9kb promoter fragment
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site Spe1 (not destroyed)
- 5′ sequencing primer TGGAAGGTGCCACTCCCACTGT
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Hb9-CD14 was a gift from Ivo Lieberam (Addgene plasmid # 204344 ; http://n2t.net/addgene:204344 ; RRID:Addgene_204344) -
For your References section:
Aberrant axon initial segment plasticity and intrinsic excitability of ALS hiPSC motor neurons. Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I. Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28. 10.1016/j.celrep.2023.113509 PubMed 38019651