Skip to main content

PB-CAG-ChR2-YFP
(Plasmid #204345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204345 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXL-BacII
  • Backbone manufacturer
    Malcolm Fraser (see PMID: 17233894)
  • Backbone size w/o insert (bp) 3400
  • Total vector size (bp) 9200
  • Modifications to backbone
    A cassette consisting of the CAG promoter, the ChR2-YFP gene (PMID: 16116447), a bGH-poly-A site and a FRT-Hygro selection cassette was inserted between the ITR transposon sites.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChR2-YFP
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    1661
  • Mutation
    C-terminus (aa315-737) is deleted - PMID: 14615590; H134R mutation - PMID: 20203662
  • GenBank ID
    AF461397
  • Promoter CAG
  • Tag / Fusion Protein
    • Yellow fluorescent protein (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (not destroyed)
  • 3′ cloning site EcoR1 (destroyed during cloning)
  • 5′ sequencing primer GTGACCGGCGGCTCTAGCTAGA
  • 3′ sequencing primer GGCCACTTGTGTAGCGCCAAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Karl Deisseroth (MTA with King's College London).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-CAG-ChR2-YFP was a gift from Ivo Lieberam (Addgene plasmid # 204345 ; http://n2t.net/addgene:204345 ; RRID:Addgene_204345)
  • For your References section:

    Aberrant axon initial segment plasticity and intrinsic excitability of ALS hiPSC motor neurons. Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I. Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28. 10.1016/j.celrep.2023.113509 PubMed 38019651