Skip to main content

CLYBL-TO-PAX7
(Plasmid #204346)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204346 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCM-CLYBL-hNIL
  • Backbone manufacturer
    Michael Ward - plasmid# 105841
  • Backbone size w/o insert (bp) 10040
  • Total vector size (bp) 13283
  • Modifications to backbone
    hNIL genes were replaced by hPAX7 gene. mCherry reporter cassette was removed.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human PAX7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1557
  • GenBank ID
    NM_002584
  • Promoter TRE3G

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCACCCCACAGTGGTTTAC
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CLYBL-TO-PAX7 was a gift from Ivo Lieberam (Addgene plasmid # 204346 ; http://n2t.net/addgene:204346 ; RRID:Addgene_204346)
  • For your References section:

    Aberrant axon initial segment plasticity and intrinsic excitability of ALS hiPSC motor neurons. Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I. Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28. 10.1016/j.celrep.2023.113509 PubMed 38019651