CLYBL-TO-PAX7
(Plasmid
#204346)
-
PurposeKnock-in vector to insert a dox-inducible PAX7 transgene into the CYBL locus in human pluripotent stem cells. PAX7 induction results in myogenic differentiation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCM-CLYBL-hNIL
-
Backbone manufacturerMichael Ward - plasmid# 105841
- Backbone size w/o insert (bp) 10040
- Total vector size (bp) 13283
-
Modifications to backbonehNIL genes were replaced by hPAX7 gene. mCherry reporter cassette was removed.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman PAX7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1557
-
GenBank IDNM_002584
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCACCCCACAGTGGTTTAC
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CLYBL-TO-PAX7 was a gift from Ivo Lieberam (Addgene plasmid # 204346 ; http://n2t.net/addgene:204346 ; RRID:Addgene_204346) -
For your References section:
Aberrant axon initial segment plasticity and intrinsic excitability of ALS hiPSC motor neurons. Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I. Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28. 10.1016/j.celrep.2023.113509 PubMed 38019651