Skip to main content

PCRbluntII-pHES7-STOPgRNA
(Plasmid #204349)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204349 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR-bluntII
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 3974
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pig HES7-STOP-gRNA
  • gRNA/shRNA sequence
    GACCTTGGCCCTGAGCTTTG
  • Species
    Sus domesticus (pig)
  • Entrez Gene
    HES7 (a.k.a. SCDO4, bHLHb37, hHes7)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCRbluntII-pHES7-STOPgRNA was a gift from Li-Fang Chu (Addgene plasmid # 204349 ; http://n2t.net/addgene:204349 ; RRID:Addgene_204349)
  • For your References section:

    Efficient derivation of transgene-free porcine induced pluripotent stem cells enables in vitro modeling of species-specific developmental timing. Conrad JV, Meyer S, Ramesh PS, Neira JA, Rusteika M, Mamott D, Duffin B, Bautista M, Zhang J, Hiles E, Higgins EM, Steill J, Freeman J, Ni Z, Liu S, Ungrin M, Rancourt D, Clegg DO, Stewart R, Thomson JA, Chu LF. Stem Cell Reports. 2023 Dec 12;18(12):2328-2343. doi: 10.1016/j.stemcr.2023.10.009. Epub 2023 Nov 9. 10.1016/j.stemcr.2023.10.009 PubMed 37949072