PCRbluntII-pHES7-STOPgRNA
(Plasmid
#204349)
-
PurposegRNA to target pig HES7 stop codon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR-bluntII
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 3974
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePig HES7-STOP-gRNA
-
gRNA/shRNA sequenceGACCTTGGCCCTGAGCTTTG
-
SpeciesSus domesticus (pig)
-
Entrez GeneHES7 (a.k.a. SCDO4, bHLHb37, hHes7)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 for
- 3′ sequencing primer M13 Rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCRbluntII-pHES7-STOPgRNA was a gift from Li-Fang Chu (Addgene plasmid # 204349 ; http://n2t.net/addgene:204349 ; RRID:Addgene_204349) -
For your References section:
Efficient derivation of transgene-free porcine induced pluripotent stem cells enables in vitro modeling of species-specific developmental timing. Conrad JV, Meyer S, Ramesh PS, Neira JA, Rusteika M, Mamott D, Duffin B, Bautista M, Zhang J, Hiles E, Higgins EM, Steill J, Freeman J, Ni Z, Liu S, Ungrin M, Rancourt D, Clegg DO, Stewart R, Thomson JA, Chu LF. Stem Cell Reports. 2023 Dec 12;18(12):2328-2343. doi: 10.1016/j.stemcr.2023.10.009. Epub 2023 Nov 9. 10.1016/j.stemcr.2023.10.009 PubMed 37949072