pET28C-mCherry-YTHDF2
(Plasmid
#204406)
-
PurposeE. coli expression of full-length YTHDF2 with an N-terminal mCherry tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET28C(+)
-
Backbone manufacturerNovagen (EMD Millipore)
- Backbone size w/o insert (bp) 5369
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYTHDF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2455
-
Entrez GeneYTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
- Promoter T7
-
Tag
/ Fusion Protein
- 6x-His; mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #102275
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28C-mCherry-YTHDF2 was a gift from Samie Jaffrey (Addgene plasmid # 204406 ; http://n2t.net/addgene:204406 ; RRID:Addgene_204406) -
For your References section:
Biomolecular condensates create phospholipid-enriched microenvironments. Dumelie JG, Chen Q, Miller D, Attarwala N, Gross SS, Jaffrey SR. Nat Chem Biol. 2023 Nov 16. doi: 10.1038/s41589-023-01474-4. 10.1038/s41589-023-01474-4 PubMed 37973889