Skip to main content

pET28C-mCherry-YTHDF2
(Plasmid #204406)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204406 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28C(+)
  • Backbone manufacturer
    Novagen (EMD Millipore)
  • Backbone size w/o insert (bp) 5369
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YTHDF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2455
  • Entrez Gene
    YTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
  • Promoter T7
  • Tag / Fusion Protein
    • 6x-His; mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #102275

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28C-mCherry-YTHDF2 was a gift from Samie Jaffrey (Addgene plasmid # 204406 ; http://n2t.net/addgene:204406 ; RRID:Addgene_204406)
  • For your References section:

    Biomolecular condensates create phospholipid-enriched microenvironments. Dumelie JG, Chen Q, Miller D, Attarwala N, Gross SS, Jaffrey SR. Nat Chem Biol. 2023 Nov 16. doi: 10.1038/s41589-023-01474-4. 10.1038/s41589-023-01474-4 PubMed 37973889