pUCXMG
(Plasmid #204409)

• Purpose: (Empty Backbone) Expression plasmid for cloning of FatI digested metagenomic DNA into a compatible NcoI site
• Depositing Lab: David Ackerley
• Publication: Rich et al bioRxiv. 2023 Mar 25:2023.03.24.534183. doi: 10.1101/2023.03.24.534183. Preprint.

Backbone

• Vector backbone: pUCX
• Backbone manufacturer: Addgene #60681
• Backbone size (bp): 4191
• Modifications to backbone: The pUCXMG vector was generated from the pUCX vector backbone with a replacement of the ampicillin resistance marker by a gentamycin resistance cassette and introduction of a modified multiple-cloning site, containing a His6 tag and a downstream NcoI restriction site. For replacement of the antibiotic resistance gene, the pUCX vector was amplified with forward primer CTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC and reverse primer ACTCTTCCTTTTTCAATATTATTGAAGC and assembled with a synthetic gentamycin cassette ordered from Twist Bioscience containing 5’ and 3’ 20-bp pUCX homology arms, using NEBuilder® HiFi DNA Assembly (New England Biolabs). A synthetic cloning site comprising an NcoI recognition sequence flanked by XbaI and HindIII restriction sites was ordered from Twist Bioscience and used to replace the XbaI-HindIII region of the pUCX multiple cloning site by restriction cloning.
• Vector type: Bacterial Expression
• Promoter: tac
• Tag / Fusion Protein:
  • His6 (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: GACATCATAACGGTTCTG
• 3′ sequencing primer: GTTTCACTTCTGAGTTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry