pUCXMG
(Plasmid
#204409)
-
Purpose(Empty Backbone) Expression plasmid for cloning of FatI digested metagenomic DNA into a compatible NcoI site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCX
-
Backbone manufacturerAddgene #60681
- Backbone size (bp) 4191
-
Modifications to backboneThe pUCXMG vector was generated from the pUCX vector backbone with a replacement of the ampicillin resistance marker by a gentamycin resistance cassette and introduction of a modified multiple-cloning site, containing a His6 tag and a downstream NcoI restriction site. For replacement of the antibiotic resistance gene, the pUCX vector was amplified with forward primer CTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC and reverse primer ACTCTTCCTTTTTCAATATTATTGAAGC and assembled with a synthetic gentamycin cassette ordered from Twist Bioscience containing 5’ and 3’ 20-bp pUCX homology arms, using NEBuilder® HiFi DNA Assembly (New England Biolabs). A synthetic cloning site comprising an NcoI recognition sequence flanked by XbaI and HindIII restriction sites was ordered from Twist Bioscience and used to replace the XbaI-HindIII region of the pUCX multiple cloning site by restriction cloning.
-
Vector typeBacterial Expression
- Promoter tac
-
Tag
/ Fusion Protein
- His6 (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer GACATCATAACGGTTCTG
- 3′ sequencing primer GTTTCACTTCTGAGTTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCXMG was a gift from David Ackerley (Addgene plasmid # 204409 ; http://n2t.net/addgene:204409 ; RRID:Addgene_204409) -
For your References section:
A metagenomic library cloning strategy that promotes high-level expression of captured genes to enable efficient functional screening. Rich MH, Sharrock AV, Mulligan TS, Matthews F, Brown AS, Lee-Harwood HR, Williams EM, Copp JN, Little RF, Francis JJ, Horvat CN, Stevenson LJ, Owen JG, Saxena MT, Mumm JS, Ackerley DF. bioRxiv. 2023 Mar 25:2023.03.24.534183. doi: 10.1101/2023.03.24.534183. Preprint. 10.1101/2023.03.24.534183 PubMed 36993673