Skip to main content

pLenti HsATP10B - EmGFP
(Plasmid #204474)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204474 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiviral transferplasmid
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11402
  • Total vector size (bp) 16546
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    ATP10B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4386
  • Entrez Gene
    ATP10B (a.k.a. ATPVB)
  • Promoter CMV
  • Tag / Fusion Protein
    • EmGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EmGFP
  • Insert Size (bp)
    720
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.01.543059 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti HsATP10B - EmGFP was a gift from Veerle Baekelandt (Addgene plasmid # 204474 ; http://n2t.net/addgene:204474 ; RRID:Addgene_204474)
  • For your References section:

    The lipid flippase ATP10B enables cellular lipid uptake under stress conditions. Wouters R, Beletchi I, Van den Haute C, Baekelandt V, Martin S, Eggermont J, Vangheluwe P. Biochim Biophys Acta Mol Cell Res. 2024 Feb;1871(2):119652. doi: 10.1016/j.bbamcr.2023.119652. Epub 2023 Dec 11. 10.1016/j.bbamcr.2023.119652 PubMed 38086447