aCE106
(Plasmid
#204496)
-
PurposeSmall molecule helper circuit
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplasmid DNA
-
Vector typeMammalian Expression, Bacterial Expression, Synthetic Biology
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namertTA3
- Promoter hEF1a
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTAAAGTGCATCTCGGCACC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePhIF-ABI
- Promoter hEF1a
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CAGGTAAGTGCCGTGTGTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameVPR-Pyl1
- Promoter hEF1a
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CAGGTAAGTGCCGTGTGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aCE106 was a gift from Ron Weiss (Addgene plasmid # 204496 ; http://n2t.net/addgene:204496 ; RRID:Addgene_204496) -
For your References section:
Synthetic symmetry breaking and programmable multicellular structure formation. Wauford N, Patel A, Tordoff J, Enghuus C, Jin A, Toppen J, Kemp ML, Weiss R. Cell Syst. 2023 Sep 20;14(9):806-818.e5. doi: 10.1016/j.cels.2023.08.001. Epub 2023 Sep 8. 10.1016/j.cels.2023.08.001 PubMed 37689062