Skip to main content

pET22b 6His SpyCatcher-GRFT
(Plasmid #204502)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204502 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-22b
  • Backbone size w/o insert (bp) 5354
  • Total vector size (bp) 6155
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GRFT
  • Species
    Griffithsia sp.
  • Insert Size (bp)
    801
  • GenBank ID
    58200458
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert)
    • SpyCatcher (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttattaatactgttcataataaatatccaggctatccag
  • 3′ sequencing primer CTCTAGATTAACTTTAAGAAGGAGGGTACCatgggtagcagccaccatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b 6His SpyCatcher-GRFT was a gift from Urartu Seker (Addgene plasmid # 204502 ; http://n2t.net/addgene:204502 ; RRID:Addgene_204502)
  • For your References section:

    A Genetically Engineered Biofilm Material for SARS-CoV-2 Capturing and Isolation. Ozkul G, Kehribar ES, Ahan RE, Koksaldi IC, Ozkul A, Dinc B, Aydogan S, Seker UOS. Adv Mater Interfaces. 2022 Sep 13:2201126. doi: 10.1002/admi.202201126. 10.1002/admi.202201126 PubMed 36248312