pET22b 6His SpyCatcher-GRFT
(Plasmid #204502)

• Purpose: Bacterial expression of GRFT with N-terminal SpyCatcher fusion and GS linker
• Depositing Lab: Urartu Seker
• Publication: Ozkul et al Adv Mater Interfaces. 2022 Sep 13:2201126. doi: 10.1002/admi.202201126.

Backbone

• Vector backbone: pET-22b
• Backbone size w/o insert (bp): 5354
• Total vector size (bp): 6155
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GRFT
• Species: Griffithsia sp.
• Insert Size (bp): 801
• GenBank ID: 58200458
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert)
  • SpyCatcher (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ttattaatactgttcataataaatatccaggctatccag
• 3′ sequencing primer: CTCTAGATTAACTTTAAGAAGGAGGGTACCatgggtagcagccaccatc

Resource Information

• Supplemental Documents:
  • pet-22b-6his-spycatcher-grft.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry