Skip to main content

pHIT246
(Plasmid #204507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204507 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFJ151
  • Backbone manufacturer
    Addgene #19330
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2xFLAG::csr-1 (C. elegans)
  • Species
    C. elegans (nematode)
  • Entrez Gene
    csr-1 (a.k.a. CELE_F20D12.1)
  • Promoter csr-1 (C. elegans)
  • Tag / Fusion Protein
    • 2xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (unknown if destroyed)
  • 3′ cloning site SgfI (unknown if destroyed)
  • 5′ sequencing primer pCFJ151_near_AflII (CGGGCTACGTAATACGACTCAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2xFLAG(M2) tag in this plasmid is DYKDHDAAADYKDDD; pCFJ151 (backborn) was modified to have two copies of I-SceI sites

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHIT246 was a gift from Yuji Kohara (Addgene plasmid # 204507 ; http://n2t.net/addgene:204507 ; RRID:Addgene_204507)
  • For your References section:

    A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K. EMBO J. 2023 Jun 1;42(11):e105002. doi: 10.15252/embj.2020105002. Epub 2023 Apr 20. 10.15252/embj.2020105002 PubMed 37078421