pHIT246
(Plasmid
#204507)
-
Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematode
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFJ151
-
Backbone manufacturerAddgene #19330
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2xFLAG::csr-1 (C. elegans)
-
SpeciesC. elegans (nematode)
-
Entrez Genecsr-1 (a.k.a. CELE_F20D12.1)
- Promoter csr-1 (C. elegans)
-
Tag
/ Fusion Protein
- 2xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (unknown if destroyed)
- 3′ cloning site SgfI (unknown if destroyed)
- 5′ sequencing primer pCFJ151_near_AflII (CGGGCTACGTAATACGACTCAC)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2xFLAG(M2) tag in this plasmid is DYKDHDAAADYKDDD; pCFJ151 (backborn) was modified to have two copies of I-SceI sites
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIT246 was a gift from Yuji Kohara (Addgene plasmid # 204507 ; http://n2t.net/addgene:204507 ; RRID:Addgene_204507) -
For your References section:
A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K. EMBO J. 2023 Jun 1;42(11):e105002. doi: 10.15252/embj.2020105002. Epub 2023 Apr 20. 10.15252/embj.2020105002 PubMed 37078421