pBV90
(Plasmid
#204601)
-
PurposeExpresses OsTir1-3X Myc from S. cerevisiae ADH1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204601 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 9083
-
Vector typeBacterial Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOs Tir1
-
Alt nametransport inhibitor response
-
SpeciesOryza sativa
-
Insert Size (bp)6430
-
GenBank IDXP_015635915.1
-
Entrez GeneLOC4338955 (a.k.a. OSNPB_050449500, B1122D01.5, COI1B, OsCOI1H, OsCOI1b, OsJ_18742)
- Promoter ScADH1
-
Tag
/ Fusion Protein
- Myc epitope tags
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAGGCGATTAAGTTGGGTAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBV90 was a gift from Scott Moye-Rowley (Addgene plasmid # 204601 ; http://n2t.net/addgene:204601 ; RRID:Addgene_204601)