pPV-C1-crRNA(DMD#20_DMD#23)-EF1a-BA
(Plasmid
#204620)
-
PurposeExpression vector of crRNA (DMD#20) targeting the dystrophin intron 44 just upstream of exon 45, and crRNA(DMD#23)targeting the dystrophin intron 55 just downstream of exon 55. Blasticidin selectable.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPV
- Backbone size w/o insert (bp) 5460
-
Vector typeCRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrRNA#20 (targeting DMD intron44) and crRNA#23 (targeting DMD intron 55)
-
gRNA/shRNA sequencecrRNA(DMD#20): ctgacagtagaccccagtacatgcttcctaaa, crRNA(DMD#23): tcttggtgagaatcatattctgtagtacaagg
-
SpeciesH. sapiens (human)
-
Insert Size (bp)240
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer gatcgctctagactagtggatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPV-C1-crRNA(DMD#20_DMD#23)-EF1a-BA was a gift from Akitsu Hotta (Addgene plasmid # 204620 ; http://n2t.net/addgene:204620 ; RRID:Addgene_204620) -
For your References section:
Dual CRISPR-Cas3 system for inducing multi-exon skipping in DMD patient-derived iPSCs. Kita Y, Okuzaki Y, Naoe Y, Lee J, Bang U, Okawa N, Ichiki A, Jonouchi T, Sakurai H, Kojima Y, Hotta A. Stem Cell Reports. 2023 Sep 12;18(9):1753-1765. doi: 10.1016/j.stemcr.2023.07.007. Epub 2023 Aug 24. 10.1016/j.stemcr.2023.07.007 PubMed 37625413