Skip to main content

P24-pZE-SUMO-KaTTA
(Plasmid #204633)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204633 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZE Vector
  • Backbone size w/o insert (bp) 2915
  • Total vector size (bp) 4474
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    His-SUMO-TEV-KaTTA
  • Species
    Synthetic
  • Insert Size (bp)
    1574
  • Promoter PLtetO-1 promoter
  • Tag / Fusion Protein
    • His Tag; SUMO Tag; TEV Protease Site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagtccctatcagtgatagagattgac
  • 3′ sequencing primer tcatgggatcccccatcaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P24-pZE-SUMO-KaTTA was a gift from Aditya Kunjapur (Addgene plasmid # 204633 ; http://n2t.net/addgene:204633 ; RRID:Addgene_204633)
  • For your References section:

    Discovery of L-threonine transaldolases for enhanced biosynthesis of beta-hydroxylated amino acids. Jones MA, Butler ND, Anderson SR, Wirt SA, Govil I, Lyu X, Fang Y, Kunjapur AM. Commun Biol. 2023 Sep 11;6(1):929. doi: 10.1038/s42003-023-05293-0. 10.1038/s42003-023-05293-0 PubMed 37696954