U6-AsCas12f-full-length-sgRNA
(Plasmid
#204638)
-
PurposeExpression of full-length AsCas12f sgRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonede novo assembled
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefull-length AsCas12f sgRNA
-
gRNA/shRNA sequenceAGGCATCACTGCCCCCTGAT
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-AsCas12f-full-length-sgRNA was a gift from Weixin Tang (Addgene plasmid # 204638 ; http://n2t.net/addgene:204638 ; RRID:Addgene_204638) -
For your References section:
An engineered hypercompact CRISPR-Cas12f system with boosted gene-editing activity. Wu T, Liu C, Zou S, Lyu R, Yang B, Yan H, Zhao M, Tang W. Nat Chem Biol. 2023 Jul 3. doi: 10.1038/s41589-023-01380-9. 10.1038/s41589-023-01380-9 PubMed 37400536