Skip to main content

pHB1
(Plasmid #204668)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204668 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 3660
  • Modifications to backbone
    The insert in pHB1 was constructed using a gBlock gene fragment from IDT (gHB1) encoding a custom Left Linker sequence (ACGAGACGAGCTTCTTATATATGCTTCGCCAG), an Erm-resistance cassette flanked by FRT sites, and a custom spacer sequence (AGCGCTCATGCACTTGATTCC). Oligos HB22 and HB23 were used to PCR amplify the gBlock flanked by HindIII and BamHI sites. This fragment was then cloned into pUC19 that was digested with HindIII/BamHI and treated with Antarctic Phosphatase. HB22: GGTCAGCCTCTAATGGCTCGTAAGATAGTG. HB23: TTGGAGAGCCAGCTGCGTTCGCTAA.
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FRT-erm-FRT
  • Alt name
    erythromycin resistance
  • Alt name
    flippase recognition target
  • Insert Size (bp)
    998

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHB1 was a gift from Mark Mandel (Addgene plasmid # 204668 ; http://n2t.net/addgene:204668 ; RRID:Addgene_204668)
  • For your References section:

    Multiplexed Competition in a Synthetic Squid Light Organ Microbiome Using Barcode-Tagged Gene Deletions. Burgos HL, Burgos EF, Steinberger AJ, Suen G, Mandel MJ. mSystems. 2020 Dec 15;5(6):e00846-20. doi: 10.1128/mSystems.00846-20. 10.1128/mSystems.00846-20 PubMed 33323415