pHB1
(Plasmid
#204668)
-
PurposepUC19 containing the LL-FRT-erm-FRT-spacer sequence which serves as template for BarSeq deletion constructs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 3660
-
Modifications to backboneThe insert in pHB1 was constructed using a gBlock gene fragment from IDT (gHB1) encoding a custom Left Linker sequence (ACGAGACGAGCTTCTTATATATGCTTCGCCAG), an Erm-resistance cassette flanked by FRT sites, and a custom spacer sequence (AGCGCTCATGCACTTGATTCC). Oligos HB22 and HB23 were used to PCR amplify the gBlock flanked by HindIII and BamHI sites. This fragment was then cloned into pUC19 that was digested with HindIII/BamHI and treated with Antarctic Phosphatase. HB22: GGTCAGCCTCTAATGGCTCGTAAGATAGTG. HB23: TTGGAGAGCCAGCTGCGTTCGCTAA.
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFRT-erm-FRT
-
Alt nameerythromycin resistance
-
Alt nameflippase recognition target
-
Insert Size (bp)998
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHB1 was a gift from Mark Mandel (Addgene plasmid # 204668 ; http://n2t.net/addgene:204668 ; RRID:Addgene_204668) -
For your References section:
Multiplexed Competition in a Synthetic Squid Light Organ Microbiome Using Barcode-Tagged Gene Deletions. Burgos HL, Burgos EF, Steinberger AJ, Suen G, Mandel MJ. mSystems. 2020 Dec 15;5(6):e00846-20. doi: 10.1128/mSystems.00846-20. 10.1128/mSystems.00846-20 PubMed 33323415