Skip to main content

pLenti-CMV-paGFP-bPAC-CAAX
(Plasmid #204671)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204671 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 8538
  • Total vector size (bp) 10410
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    paGFP-bPAC-CAAX
  • Species
    Synthetic; Beggiatoa sp.
  • Insert Size (bp)
    1872
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agaagacaccgactctagaggatccATGGTGAGCAAGGGCGAG
  • 3′ sequencing primer gaattctcacataattacacactttgtctttgacttctttttcttctttttaccaccggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-paGFP-bPAC-CAAX was a gift from Adam Cohen (Addgene plasmid # 204671 ; http://n2t.net/addgene:204671 ; RRID:Addgene_204671)
  • For your References section:

    All-optical mapping of cAMP transport reveals rules of sub-cellular localization. Xiang KM, Park P, Koren SA, Hayward RF, Cohen AE. bioRxiv 2023 10.1101/2023.06.27.546633