pDIV296
(Plasmid
#204687)
-
PurposeAMA1 plasmid with nat1 resistance marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonecustom
- Total vector size (bp) 9273
-
Modifications to backboneAMA1 element
-
Vector typeBacterial Expression ; Fungal expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenat1
-
SpeciesSynthetic; ; codon optimized for A. niger
-
Insert Size (bp)573
- Promoter Aspergillus nidulans trpC promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCTAGTGGAGGTCAACACATC
- 3′ sequencing primer CTGTACCATCGTATAAAGCTGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDIV296 was a gift from Uffe Mortensen (Addgene plasmid # 204687 ; http://n2t.net/addgene:204687 ; RRID:Addgene_204687) -
For your References section:
A Mad7 System for Genetic Engineering of Filamentous Fungi. Vanegas KG, Rendsvig JKH, Jarczynska ZD, Cortes MVCB, van Esch AP, Morera-Gomez M, Contesini FJ, Mortensen UH. J Fungi (Basel). 2022 Dec 22;9(1):16. doi: 10.3390/jof9010016. 10.3390/jof9010016 PubMed 36675838