p186-RV-CAG-dio-mScarlet-T2A-mVenus
(Plasmid
#204740)
-
PurposeConditional expression of target gene mVenus with fluorescent reporter mScarlet
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep185-RV-CAG-dio-mScarlet-T2A
- Total vector size (bp) 8609
-
Modifications to backboneaddition of mVenus sequence
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer AGCGTTCGTACTGTTCCACC
- 3′ sequencing primer ttacttgtacagctcgtccatgccg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p186-RV-CAG-dio-mScarlet-T2A-mVenus was a gift from Lynette Lim (Addgene plasmid # 204740 ; http://n2t.net/addgene:204740 ; RRID:Addgene_204740) -
For your References section:
Cortical somatostatin long-range projection neurons and interneurons exhibit divergent developmental trajectories. Fisher J, Verhagen M, Long Z, Moissidis M, Yan Y, He C, Wang J, Micoli E, Alastruey CM, Moors R, Marin O, Mi D, Lim L. Neuron. 2023 Dec 7:S0896-6273(23)00887-5. doi: 10.1016/j.neuron.2023.11.013. 10.1016/j.neuron.2023.11.013 PubMed 38086373