Skip to main content

pR008_APAD
(Plasmid #204818)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204818 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGIG
  • Backbone manufacturer
    Connie Cepko Lab
  • Backbone size w/o insert (bp) 6124
  • Total vector size (bp) 8076
  • Vector type
    Mammalian Expression
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat Apobec1 and human ADAR2 deaminase domain with engineered sites
  • Alt name
    Apobec1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1950
  • GenBank ID
    NM_012907
  • Entrez Gene
    Apobec1 (a.k.a. REPR, apobec-1)
  • Promoter chicken β-actin promoter
  • Tags / Fusion Proteins
    • HA and Flag (N terminal on insert)
    • huADAR2dd (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTAACCATGTTCATGCCTTC
  • 3′ sequencing primer GGGGGCGGAATTTACGTAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    rApobec1-XTEN was amplified from pCMV-BE3 (Addgene #73021), and hADAR2dd was amplified from pC0055 (Addgene #103871) .

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR008_APAD was a gift from Xiaochang Zhang (Addgene plasmid # 204818 ; http://n2t.net/addgene:204818 ; RRID:Addgene_204818)
  • For your References section:

    PIE-seq: identifying RNA-binding protein targets by dual RNA-deaminase editing and sequencing. Ruan X, Hu K, Zhang X. Nat Commun. 2023 Jun 6;14(1):3275. doi: 10.1038/s41467-023-39054-8. 10.1038/s41467-023-39054-8 PubMed 37280234