pR008_APAD
(Plasmid
#204818)
-
PurposeExpression Apobec1-ADAR2dd fusion protein as PIE-RBP control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGIG
-
Backbone manufacturerConnie Cepko Lab
- Backbone size w/o insert (bp) 6124
- Total vector size (bp) 8076
-
Vector typeMammalian Expression
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat Apobec1 and human ADAR2 deaminase domain with engineered sites
-
Alt nameApobec1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1950
-
GenBank IDNM_012907
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
- Promoter chicken β-actin promoter
-
Tags
/ Fusion Proteins
- HA and Flag (N terminal on insert)
- huADAR2dd (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTAACCATGTTCATGCCTTC
- 3′ sequencing primer GGGGGCGGAATTTACGTAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byrApobec1-XTEN was amplified from pCMV-BE3 (Addgene #73021), and hADAR2dd was amplified from pC0055 (Addgene #103871) .
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR008_APAD was a gift from Xiaochang Zhang (Addgene plasmid # 204818 ; http://n2t.net/addgene:204818 ; RRID:Addgene_204818) -
For your References section:
PIE-seq: identifying RNA-binding protein targets by dual RNA-deaminase editing and sequencing. Ruan X, Hu K, Zhang X. Nat Commun. 2023 Jun 6;14(1):3275. doi: 10.1038/s41467-023-39054-8. 10.1038/s41467-023-39054-8 PubMed 37280234