pDIV313
(Plasmid
#204956)
-
PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. niger
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDIV300
- Total vector size (bp) 16143
-
Modifications to backboneAMA1 element
-
Vector typeBacterial Expression, CRISPR ; Fungal expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMad7
-
SpeciesSynthetic; codon optimized for A. niger
-
Insert Size (bp)3816
- Promoter Aspergillus nidulans tef1 promoter
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTTCTCTGCTCAGCACCTCTACG
- 3′ sequencing primer GCTTTACGGGAAGAGCTGAGAT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehph (hygromycin resistance marker)
-
SpeciesEscherichia coli
-
Insert Size (bp)1026
- Promoter Aspergillus nidulans trpC promoter
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCTAGTGGAGGTCAACACATC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namesgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
-
SpeciesSynthetic
-
Insert Size (bp)56
- Promoter Aspergillus fumigatus U3 promoter
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer AGGTTCTCCTAACGCTTGGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDIV313 was a gift from Uffe Mortensen (Addgene plasmid # 204956 ; http://n2t.net/addgene:204956 ; RRID:Addgene_204956) -
For your References section:
A Mad7 System for Genetic Engineering of Filamentous Fungi. Vanegas KG, Rendsvig JKH, Jarczynska ZD, Cortes MVCB, van Esch AP, Morera-Gomez M, Contesini FJ, Mortensen UH. J Fungi (Basel). 2022 Dec 22;9(1):16. doi: 10.3390/jof9010016. 10.3390/jof9010016 PubMed 36675838