pDIV313
(Plasmid #204956)

• Purpose: AMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. niger
• Depositing Lab: Uffe Mortensen
• Publication: Vanegas et al J Fungi (Basel). 2022 Dec 22;9(1):16. doi: 10.3390/jof9010016.

Backbone

• Vector backbone: pDIV300
• Total vector size (bp): 16143
• Modifications to backbone: AMA1 element
• Vector type: Bacterial Expression, CRISPR ; Fungal expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Mad7
• Species: Synthetic; codon optimized for A. niger
• Insert Size (bp): 3816
• Promoter: Aspergillus nidulans tef1 promoter
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CTTCTCTGCTCAGCACCTCTACG
• 3′ sequencing primer: GCTTTACGGGAAGAGCTGAGAT

Gene/Insert 2

• Gene/Insert name: hph (hygromycin resistance marker)
• Species: Escherichia coli
• Insert Size (bp): 1026
• Promoter: Aspergillus nidulans trpC promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCTAGTGGAGGTCAACACATC

Gene/Insert 3

• Gene/Insert name: sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
• Species: Synthetic
• Insert Size (bp): 56
• Promoter: Aspergillus fumigatus U3 promoter

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: AGGTTCTCCTAACGCTTGGC

Resource Information

• Supplemental Documents:
  • pDIV313_pAMA1-hygB-Mad7-PS-albA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry