TaraACR2-pmCherry-C1
(Plasmid
#204961)
-
PurposeExpression of TaraACR2 in fusion with mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 5489
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTaraACR2
-
Speciesunknown
-
Insert Size (bp)786
- Promoter CMV (+ enhancer)
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BshTI (not destroyed)
- 5′ sequencing primer CMV-fwd: GCAAATGGGCGGTAGGCGT
- 3′ sequencing primer EGFP-C1-rev: AACCATTATAAGCTGCAATAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.09.544329 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TaraACR2-pmCherry-C1 was a gift from Peter Hegemann (Addgene plasmid # 204961 ; http://n2t.net/addgene:204961 ; RRID:Addgene_204961) -
For your References section:
Robust optogenetic inhibition with red-light-sensitive anion-conducting channelrhodopsins. Oppermann J, Rozenberg A, Fabrin T, Gonzalez-Cabrera C, Parker R, Beja O, Prigge M, Hegemann P. eLife. 2024 Oct 14;12:RP90100. doi: 10.7554/eLife.90100. 10.7554/eLife.90100 PubMed 39401075