MsACR1-TS-Kv-P2A-mCerulean3-pAAV-CaMKII
(Plasmid
#204970)
-
PurposeSoma-targeted neuronal expression of MsACR1 and mCerulean3 separated by a P2A site.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV2-hSyn
- Backbone size w/o insert (bp) 3785
- Total vector size (bp) 5582
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMsACR1
-
SpeciesMantoniella squamata
-
Insert Size (bp)723
- Promoter CaMKII
-
Tag
/ Fusion Protein
- mCerulean3 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CaMKII-fwd: gtggcccctagttctgggggcag
- 3′ sequencing primer WPRE-rev: CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.09.544329 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MsACR1-TS-Kv-P2A-mCerulean3-pAAV-CaMKII was a gift from Peter Hegemann (Addgene plasmid # 204970 ; http://n2t.net/addgene:204970 ; RRID:Addgene_204970) -
For your References section:
Robust optogenetic inhibition with red-light-sensitive anion-conducting channelrhodopsins. Oppermann J, Rozenberg A, Fabrin T, Gonzalez-Cabrera C, Parker R, Beja O, Prigge M, Hegemann P. eLife. 2024 Oct 14;12:RP90100. doi: 10.7554/eLife.90100. 10.7554/eLife.90100 PubMed 39401075