pV1F
(Plasmid
#205084)
-
PurposeProkaryotic expressing of AtVIP1 fused with a sequence encoding a T4SS translocation tag in A. tumefaciens.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep302T
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAtVIP1
-
Alt namearabidopsis VirE2-interacting Protein 1
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1023
-
GenBank IDNC_003070.9
- Promoter agorbacterium virB operon promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CGGGGTACCATGCCTGTCGAGTCGGCTGAGAATATA
- 3′ sequencing primer CCGGAATTCTCATAGACCGCGCGTTGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pV1F was a gift from Suomeng Dong (Addgene plasmid # 205084 ; http://n2t.net/addgene:205084 ; RRID:Addgene_205084) -
For your References section:
A modified Agrobacterium-mediated transformation for two oomycete pathogens. Wang L, Zhao F, Liu H, Chen H, Zhang F, Li S, Sun T, Nekrasov V, Huang S, Dong S. PLoS Pathog. 2023 Apr 21;19(4):e1011346. doi: 10.1371/journal.ppat.1011346. eCollection 2023 Apr. 10.1371/journal.ppat.1011346 PubMed 37083862