pFFLuc-IVT
(Plasmid
#205147)
-
PurposeIVT template of FireFly luciferase stop codon between the ORF and MCS and polyA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAcGFP-C1
-
Vector typeLuciferase ; In-vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFireFly luciferase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTGTACGGTGGGAGGTCTAT
- 3′ sequencing primer GGTGGATCCCGGGCCCGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that due to the difficult of sequencing polyA regions, the exact length of the homopolymer is unknown.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFFLuc-IVT was a gift from Igor Ulitsky (Addgene plasmid # 205147 ; http://n2t.net/addgene:205147 ; RRID:Addgene_205147)