Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

dCas9-RPT6-FLAG
(Plasmid #205416)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 205416 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    dCas9-KRAB-MeCP2
  • Backbone manufacturer
    Addgene plasmid #110821
  • Backbone size w/o insert (bp) 7085
  • Total vector size (bp) 8671
  • Modifications to backbone
    Removed MeCP2 and replaced with RPT6 and FLAG
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-RPT6
  • Alt name
    Psmc5
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1215
  • Entrez Gene
    Psmc5 (a.k.a. Sug1)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ascl (not destroyed)
  • 3′ cloning site Agel (not destroyed)
  • 5′ sequencing primer GACGCTAACCTCGATAAGGTGCTTTC (5` --> 3`)
  • 3′ sequencing primer GAACAAACGACCCAACACCCG (5` --> 3`)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCas9-RPT6-FLAG was a gift from Timothy Jarome (Addgene plasmid # 205416 ; http://n2t.net/addgene:205416 ; RRID:Addgene_205416)