pD/Paro-IFN
(Plasmid
#205439)
-
PurposeA donor vector plasmid for Cre-mediated integration of paromomycin resistance (Paro) and dog IFNα-4 (IFNα-4) genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMC
-
Backbone manufacturerSystem Biosciences
-
Vector typeCre/Lox ; Chlamydomonas Expression
-
Selectable markersparomomycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedog interferon α-4 gene
-
Alt nameIFNα-4
-
Speciesdog
- Promoter Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CAGAAGGAGCGCAGCCAAAC
- 3′ sequencing primer TCCACAACAACCCACTCACAACC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameparomomycin resistance gene
-
Alt nameParo
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer CGGCCGCAGCTTCTTCTCTTTAACC
- 3′ sequencing primer CGTTGGCTACCCGTGATATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD/Paro-IFN was a gift from Masamichi Kamihira (Addgene plasmid # 205439 ; http://n2t.net/addgene:205439 ; RRID:Addgene_205439) -
For your References section:
Novel transgenic Chlamydomonas reinhardtii strain with retargetable genomic transgene integration using Cre-loxP system. Huang G, Kawabe Y, Shirakawa K, Akiyama T, Kamihira M. J Biosci Bioeng. 2021 Nov;132(5):469-478. doi: 10.1016/j.jbiosc.2021.07.006. Epub 2021 Aug 19. 10.1016/j.jbiosc.2021.07.006 PubMed 34420898