Skip to main content
Addgene

pGL4.10 promEXOC3
(Plasmid #205467)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205467 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL4.10
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4242
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EXOC3 Promoter
  • Alt name
    SEC6 Promoter
  • Alt name
    SEC6L1 Promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2219
  • Entrez Gene
    EXOC3 (a.k.a. SEC6, SEC6L1, Sec6p)
  • Promoter EXOC3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Bglii (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer GAAGATGCCAAAAACATTAAGAAGG
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.10 promEXOC3 was a gift from Glen Borchert (Addgene plasmid # 205467 ; http://n2t.net/addgene:205467 ; RRID:Addgene_205467)

  • For your References section:

    Long G4-rich enhancers target promoters via a G4 DNA-based mechanism. DeMeis JD, Roberts JT, Delcher HA, Godang NL, Coley AB, Brown CL, Shaw MH, Naaz S, Dahal A, Alqudah SY, Nguyen KN, Nguyen AD, Paudel SS, Shell JE, Patil SS, Dang H, O'Neal WK, Knowles MR, Houserova D, Gillespie MN, Borchert GM. Nucleic Acids Res. 2025 Jan 11;53(2):gkae1180. doi: 10.1093/nar/gkae1180. 10.1093/nar/gkae1180 PubMed 39658038
Related items: