pKM-U6-reRNA-hsEMX1
              
              
                (Plasmid
                
                #205637)
              
            
            
            
          - 
            PurposereRNA guide targeting Homo sapiens EMX1
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepKM-U6-reRNA-acceptor-2xBbsI
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert namereRNA-hsEMX1
 - 
                    gRNA/shRNA sequencegtgatgggagcccttcttct
 - 
                    SpeciesH. sapiens (human)
 - 
                        Entrez GeneEMX1
 - Promoter U6
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site unknown (unknown if destroyed)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pKM-U6-reRNA-hsEMX1 was a gift from Gerald Schwank (Addgene plasmid # 205637 ; http://n2t.net/addgene:205637 ; RRID:Addgene_205637) - 
                
For your References section:
Effective genome editing with an enhanced ISDra2 TnpB system and deep learning-predicted omegaRNAs. Marquart KF, Mathis N, Mollaysa A, Muller S, Kissling L, Rothgangl T, Schmidheini L, Kulcsar PI, Allam A, Kaufmann MM, Matsushita M, Haenggi T, Cathomen T, Kopf M, Krauthammer M, Schwank G. Nat Methods. 2024 Sep 23. doi: 10.1038/s41592-024-02418-z. 10.1038/s41592-024-02418-z PubMed 39313558