Skip to main content

pKM-U6-reRNA-hsRUNX
(Plasmid #205639)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205639 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKM-U6-reRNA-acceptor-2xBbsI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    reRNA-hsRUNX
  • gRNA/shRNA sequence
    attgatggctacatatcaga
  • Species
    H. sapiens (human)
  • Entrez Gene
    RUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM-U6-reRNA-hsRUNX was a gift from Gerald Schwank (Addgene plasmid # 205639 ; http://n2t.net/addgene:205639 ; RRID:Addgene_205639)
  • For your References section:

    Effective genome editing with an enhanced ISDra2 TnpB system and deep learning-predicted omegaRNAs. Marquart KF, Mathis N, Mollaysa A, Muller S, Kissling L, Rothgangl T, Schmidheini L, Kulcsar PI, Allam A, Kaufmann MM, Matsushita M, Haenggi T, Cathomen T, Kopf M, Krauthammer M, Schwank G. Nat Methods. 2024 Sep 23. doi: 10.1038/s41592-024-02418-z. 10.1038/s41592-024-02418-z PubMed 39313558