Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LCAPOW
(Plasmid #205645)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 205645 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX-Puro
  • Backbone manufacturer
    Clontech
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-AB
  • Species
    Synthetic
  • Promoter hCMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 3′ sequencing primer PGK Reverse: GCCAGAGGCCACTTGTGTAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LCAPOW was a gift from Dapeng Wang (Addgene plasmid # 205645 ; http://n2t.net/addgene:205645 ; RRID:Addgene_205645)
  • For your References section:

    miR-AB, a miRNA-based shRNA viral toolkit for multicolor-barcoded multiplex RNAi at a single-cell level. Wang D, Xiu J, Zhao J, Luo J. EMBO Rep. 2022 Apr 5;23(4):e53691. doi: 10.15252/embr.202153691. Epub 2022 Feb 24. 10.15252/embr.202153691 PubMed 35201651