LEAPOW
(Plasmid
#205672)
-
PurposeshRNAmir backbone for RNA interference, with mOrange reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-Puro
-
Backbone manufacturerClontech
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-AB
-
SpeciesSynthetic
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 3′ sequencing primer PGK Reverse: GCCAGAGGCCACTTGTGTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LEAPOW was a gift from Dapeng Wang (Addgene plasmid # 205672 ; http://n2t.net/addgene:205672 ; RRID:Addgene_205672) -
For your References section:
miR-AB, a miRNA-based shRNA viral toolkit for multicolor-barcoded multiplex RNAi at a single-cell level. Wang D, Xiu J, Zhao J, Luo J. EMBO Rep. 2022 Apr 5;23(4):e53691. doi: 10.15252/embr.202153691. Epub 2022 Feb 24. 10.15252/embr.202153691 PubMed 35201651