pGEMHE-RnCENP-O-298-5NS-GFP
(Plasmid
#205742)
-
PurposeExpresses chimeric rat CENP-O with mouse CENP-O C-terminal RWD domain and 5 mouse-specific point mutations; C-term tagged with GFP under T7 promoter - designed for in vitro transcription
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEMHE
- Backbone size w/o insert (bp) 3043
- Total vector size (bp) 4672
-
Vector typeMammalian Expression ; In vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCENP-O
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)1629
-
MutationChimeric rat CENP-O with mouse CENP-O C-terminal RWD domain and 5 mouse-specific point mutations in residues under positive selection
-
GenBank IDNC_000078.7 (mouse) NC_051341.1 (rat)
-
Entrez GeneCenpo (a.k.a. 2810429O05Rik, 8430427C03Rik, D12Ertd482e)
-
Entrez GeneCenpo
- Promoter T7
-
Tag
/ Fusion Protein
- 5 glycines linker followed by GFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCTTCGCTATTACGCCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-RnCENP-O-298-5NS-GFP was a gift from Michael Lampson (Addgene plasmid # 205742 ; http://n2t.net/addgene:205742 ; RRID:Addgene_205742) -
For your References section:
FREEDA: An automated computational pipeline guides experimental testing of protein innovation. Dudka D, Akins RB, Lampson MA. J Cell Biol. 2023 Sep 4;222(9):e202212084. doi: 10.1083/jcb.202212084. Epub 2023 Jun 26. 10.1083/jcb.202212084 PubMed 37358475